| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
ORIGINAL RESEARCH |
From the Department of Pathology, Ohio State University Medical Center, Columbus, Ohio; Department of Pediatrics (Neonatology), Winthrop University Hospital, SUNY Stony Brook School of Medicine, Mineola, New York; and Mt. Sinai School of Medicine, New York, New York.
Address reprint requests to: Gerard J. Nuovo, MD, Department of Pathology, Ohio State University Medical Center, 450 West 10th Avenue, S 305E Rhodes Hall, Columbus, OH 43210; E-mail: gnuovomd{at}pol.net.
 |
ABSTRACT |
|---|
TOP
 ABSTRACT MATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
METHODS: Placental tissue from seven newborn infants with severe respiratory failure and subsequent neurodevelopmental abnormalities as well as ten normal controls and five cases of known placental infection (cytomegalovirus, herpes simplex virus, and parvovirus) were tested by in situ hybridization or reverse transcriptase in situ polymerase chain reaction (PCR) for adenovirus, coxsackie virus, cytomegalovirus, Epstein Barr virus, herpes simplex virus, influenza A virus, picornavirus, polyoma virus, parvovirus, respiratory syncytial virus, rotavirus, and varicella zoster virus.
RESULTS: Coxsackie virus RNA was detected in six of the seven cases, and in none of the ten normal controls or five cases with known viral infection. Viral RNA localized primarily to the Hofbauer cells and trophoblasts of the terminal villi. Immunohistochemical analysis for the coxsackie virus antigen VP1 yielded equivalent results.
CONCLUSIONS: In utero coxsackie virus of the placenta is associated with the development of severe respiratory failure and central nervous system sequelae in the newborn. This underscores the importance of detailed pathologic and viral examination of the placenta in cases of systemic illness in the newborn.
In utero viral infections are well known to cause fetal malformations, acute systemic illness in the newborn, and also significant long-term neurodevelopmental abnormalities. Rubella, cytomegalovirus, and herpes viruses have been the best studied.1–3 The role of coxsackie virus in placental infection and associated fetal morbidity and mortality has not been well documented. Although one study suggested that coxsackie virus infection occurring during the third trimester did not result in associated morbidity in newborns, others have documented avid transplacental passage of coxsackie virus in both pregnant animals and humans resulting in significant neonatal morbidity and mortality.4–10 Several reports have documented newborn infants presumed to have acquired coxsackie virus in utero either dying or developing severe long-term neurologic sequelae secondary to widespread cortical necrosis.11,12
Clinically, most coxsackie infections are diagnosed by either serology (specific IgM antibodies) or virus isolation in cell culture. However, the sensitivity of serology decreases over time from the initial point of infection, and the virus may be difficult to directly isolate. If tissue samples are available, either immunohistochemistry for viral antigens (ie, VP1), in situ hybridization for viral RNA, or reverse transcriptase in situ polymerase chain reaction (PCR) can be used to document the viral infection. In situ hybridization analyses have documented that coxsackie virus can infect a variety of cell types in children and adults resulting in myocarditis, encephalitis, hepatitis, and pneumonia.13,14 The sensitivity of in situ hybridization for RNA viruses may be improved with in situ amplification of the corresponding cDNA.15–17 In addition to improved sensitivity, this technique also offers the advantages of working with formalin-fixed tissues, which inactivates potentially dangerous viruses, as well as the use of long lasting oligoprimers, which are inexpensive and more stable in comparison with labeled RNA probes.
An important problem in obstetrics is determining specific etiologic factors in infants developing systemic illness with significant neurodevelopmental abnormalities soon after birth. It is often assumed in such cases that in utero, hypoxicischemic events may be important in the pathogenesis of the poor neurologic outcome in the child, especially when a specific infectious agent or metabolic defect cannot be definitively determined. It may be implied in such cases that the care rendered by the obstetrician was in part responsible for the poor neurologic outcome in the child. However, in utero viral infection is an alternate and plausible explanation. This report documents five cases of placental coxsackie virus infection in which there was substantial systemic illness manifested at birth and concomitant poor neonatal outcome.
|
MATERIALS AND METHODS |
|---|
|
TOP
ABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Viral Analysis
All tissues were tested for multiple viruses using either in situ hybridization (for DNA viruses associated with high copy number) or reverse transcriptase in situ PCR (for RNA viruses associated with low copy number).
In Situ Hybridization
In situ hybridization was done using a previously published protocol.15–17 In brief, the tissue was deparaffinized, proteased (30 minutes in 2 mg/mL of pepsin), washed in sterile water, then 100% of ethanol, and air dried. The probes, each from Enzo Diagnostics (Farmingdale, NY), which have been previously described,16 included adenovirus, cytomegalovirus, Epstein-Barr virus, herpes simplex virus types 1 and 2, and polyomavirus. The probe cocktails containing the biotin-labeled probe and tissues DNA were codenatured at 95C for 5 minutes, hybridized for 2 hours at 37C, then washed at high stringency (Tm -5C), followed by localization of the probe-target complex due to the action of alkaline phosphatase on the chromogen nitroblue tetrazolium and bromochloroindolyl phosphate. Nuclear fast red served as the counterstain.
Reverse Transcriptase In Situ PCR
The protocol we used has been previously described.15–17 Briefly, optimal protease digestion time was first determined using as the guide nonspecific incorporation of the reporter nucleotide (10 µM digoxigenin dUTP). Optimal protease digestion was followed by overnight incubation in RNase free-DNase (10 U per sample, Boehringer Mannheim, Indianapolis, IN) and one step reverse transcriptase/PCR using the rTth system and digoxigenin dUTP as previously described.15–17 All tissues were analyzed for the following viruses: coxsackie, influenza A, parvovirus, picornavirus, respiratory syncytial virus, rotavirus, and varicella zoster virus. The primer sequences for coxsackie viral detection were as follows: sense — CCCCGGACTGAGTATCAATA, and antisense — GCAGTTAGGATTAGCCGCAT. These primers can detect any of the B serotypes of coxsackie virus.18Additional controls for the RNA-based signal included pretreatment of the tissue with RNase digestion as previously described.15–17
Immunohistochemistry
Our protocol has been previously published.15–17 We employed the pooled antienterovirus (mouse) antibody (DAKO, Carpinteria, CA), directed against the VP1 peptide, which is highly conserved within the enterovirus group including coxsackie virus. The antigen-antibody complex was detected using the SuperSensitive peroxidase-based kit of Biogenex (San Roman, CA), as per the manufacturer’s protocol. Dilute hematoxylin served as the counterstain to the brown signal induced by the chromogen diaminobenzidine (DAB).
|
RESULTS |
|---|
|
TOP
ABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
.
|
Case 2
A 3610-g male infant was born to a 42-year-old gravida 2, para 2 woman at 39 weeks’ gestation. The pregnancy was complicated by multiple upper respiratory tract infections. Artificial rupture of membranes revealed meconium-stained amniotic fluid, and fetal tachycardia was observed. A scalp pH 1 hour before delivery was 7.24. A cesarean section was performed for fetal distress. Apgar scores were 5 and 7 at 1 and 5 minutes, and the cord pH was 7.16. The infant developed severe respiratory failure, which was treated with exogenous surfactant and mechanical ventilation (conventional and high frequency over several weeks); bacterial cultures were negative. An erythematous rash was noted consistent with a viral exanthem. The baby was anemic at birth (hematocrit 36) and developed hypotension, metabolic acidosis, and disseminated intravascular coagulopathy. Seizure activity was treated with phenobarbital. A CAT scan and magnetic resonance imaging revealed cerebral atrophy.
Case 3
A 4280-g female infant was born to a 28-year-old gravida 1, para 0 woman by cesarean section for fetal distress at 43 weeks’ gestation. The pregnancy was remarkable for a viral-like prodrome in the second trimester and the need for post-term, serial nonstress tests. A flat tracing was noted prompting delivery with Apgar scores of 4 and 7 at 1 and 5 minutes. Cord pH was 7.19. The baby was meconium stained and developed severe respiratory failure and persistent pulmonary hypertension. Complete blood count revealed elevated white blood cell counts with increased band formation. Disseminated intravascular coagulopathy and hypotension were treated with multiple transfusions and vasopressors. Seizure activity was treated with phenobarbital, and a CAT scan at 2 weeks of life revealed cerebral atrophy. The baby was noted to have significant hypotonia. The child, besides being severely mentally retarded, is also blind.
Case 4
A 1335-g male infant was born to a 29-year-old gravida 1, para 0 woman at 27 weeks’ gestation by cesarean section for fetal distress. Pregnancy was remarkable for moderate cigarette smoking. Nausea, vomiting, and weight loss occurred at 26 weeks’ gestation causing new onset of diabetic ketoacidosis. Preterm labor was treated with tocolytics and betamethasone. Diabetic ketoacidosis progressed to severe acidosis and adult respiratory distress syndrome, requiring intubation with ventilation. Loss of variability and late decelerations were noted on fetal heart rate monitoring prompting delivery. The infant was hypotonic and apneic at birth and was immediately intubated with Apgar scores of 2 and 4 at 1 and 5 minutes. He was severely acidotic and developed severe respiratory distress syndrome requiring aggressive ventilator support, surfactant therapy, and volume support. Head ultrasound revealed a grade III intraventricular hemorrhage, which progressed to obstructive hydrocephalus necessitating a ventriculoperitoneal shunt.
Case 5
A 1988-g male infant was born to a 27-year-old gravida 1, para 0 woman by cesarean section at 37 weeks’ gestation for fetal distress. Pregnancy was complicated by intrauterine growth retardation. Decreased fetal movement was noted on the day of delivery with a nonreassuring nonstress test. Pitocin augmentation of labor was associated with the appearance of meconium-stained amniotic fluid and variable decelerations prompting delivery. Apgar scores were 2 and 8 at 1 and 5 minutes. The infant developed thrombocytopenia, neutropenia, direct hyperbilirubinemia, and a macular-papular rash over the extremities. TORCH (toxoplasmosis, other viruses, rubella, cytomegalovirus, herpes simplex) titers and multiple bacterial cultures were negative. A CAT scan of the brain revealed multiple, focal areas of calcifications versus hemorrhage.
Case 6
An 850-g male infant was born to a 29-year-old gravida 1, para 0 woman by vaginal delivery at 25 weeks’ gestation. The pregnancy was remarkable for a viral-like prodrome in the second trimester. Apgar scores were 5 and 7 at 1 and 5 minutes. The child developed hyaline membrane disease. His hospital course was marked by pancytopenia, grade III/IV bilateral intraventricular hemorrhages, jaundice, and seizures. TORCH titers and multiple bacterial cultures were negative.
Case 7
A 1120-g male infant was born to a 29-year-old gravida 1, para 0 woman by vaginal delivery at 28 weeks’ gestation. There was premature rupture of the membranes associated with a fetal pericardial effusion. Because of a concomitant illness in the mother, viral titres were done, which demonstrated a markedly elevated result against coxsackie virus type B. Apgar scores were 5 and 7 at 1 and 5 minutes. The newborn died at 1 day because of respiratory failure. No autopsy was performed.
The placentas ranged in weight from 236 to 649 g. On gross examination, the only abnormalities reported were green discolored membranes caused by meconium staining and a true knot for case 2. The histologic findings of the seven reported cases were compared with placentas known to have a viral infection caused by either cytomegalovirus, herpes simplex, or parvovirus infection, and ten normal placentas from unremarkable deliveries (five cases) or voluntary terminations of pregnancy (five cases). The most common histologic finding in the 12 placental cases (five known viral infections and the seven cases included in this report) was Hofbauer cell hyperplasia, which was seen in all cases except one with herpes simplex virus infection; this was not evident in the ten normal control tissues. Four of the five cases of known viral infection showed focal calcification, and each showed focal chronic villitis as well as focal hemorrhagic vasculitis. In comparison, of the seven cases associated with profound neurologic sequela, three showed focal chronic villitis, two showed focal hemorrhagic endovasculitis, and one showed focal calcifications.
Tissues from the seven case placentas (nine tissue blocks) as well as the ten normal controls and the five cases of known viral infecton were submitted for in situ hybridization, reverse transcriptase in situ PCR, and immunohistochemical studies in a blinded fashion. In situ hybridization for adenovirus, Epstein-Barr virus, and polyomavirus was negative in each of the 22 placental tissues. Similarly, reverse transcriptase in situ PCR analysis for influenza A, picornavirus, respiratory syncytial virus, rotavirus, and varicella zoster virus was negative in all cases. Cytomegalovirus DNA was detected in the three cases known to be infected by the virus; all showed the typical viral "owl’s eye" inclusions. Also, herpes simplex virus DNA was detected in the one known case; viral inclusions were not evident. Parvoviral RNA was detected by reverse transcriptase in situ PCR in the one known case of fetal demise secondary to parvoviral infection; inclusions in nucleated red blood cells were evident. The viral nucleic acid localized to endothelial cells and Hofbauer cells in the cytomegalovirus and herpes simplex virus cases, and was restricted to the nucleated red blood cells in the parvoviral infected placenta. One of the seven cases (case 6) reported in this study was negative for all viruses tested. The other six cases were each positive for coxsackie virus. Note that in one case (case 7), coxsackie viral infection was documented in the mother at the time of delivery. Specifically, coxsackie viral RNA was detected by reverse transcriptase in situ PCR in these six cases, and in none of the ten controls or five cases of known viral infection. The signal was lost if the tissue was pretreated with RNase (Figure 1), demonstrating that it was RNA based. Immunohisto-chemical detection of coxsackie viral protein yielded similar results to the reverse transcriptase in situ PCR studies (Figure 1). Coxsackie viral RNA and protein localized primarily to the Hofbauer cells and syncytiotrophoblasts and cytotrophoblasts; occasional endothelial cells and fibroblasts also showed signal (Figures 1 and 2). As is evident from the photomicrographs, the PCR-amplified viral cDNA localized to the cytoplasm. Viral distribution was focal, with some terminal villi showing no infected cells and others demonstrating as many as 20% of the trophoblasts and 10% of the Hofbauer cells with signal. From five to ten times as many cells were positive for viral RNA compared with viral protein, presumably reflecting the greater sensitivity of reverse transcriptase in situ PCR versus immunohistochemistry. No coxsackie viral protein was detected in the normal placentas or in the tissues with documented cytomegalovirus, herpes simplex virus, or parvovirus infections.
|
|
). |
DISCUSSION |
|---|
|
TOP
ABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
In contrast to the milder illness seen in adults, affected neonates may experience severe disease related to the development of pneumonia, myocarditis, and/or meningoencephalitis.13,14 The infants may develop "sepsis-like syndromes" characterized by hypotension, leukopenia or leukocytosis, neutropenia, thrombocytopenia, and disseminated intravascular coagulopathy. Central nervous system involvement has been well documented in neonates dying of coxsackie virus infection. Lesions occur at all levels of gray matter, but are more common in the cerebrum, and consist of widespread areas of liquefaction necrosis that show relatively minimal inflammatory changes.12 Although central nervous tissue was not available for the six cases in this study, one may speculate that coxsackie viral infection of the brain could be responsible for the marked neurologic sequelae evident in each case. Indeed, we were able to detect coxsackie viral infection in neurons of a fetus who died in utero.
Interestingly, the neurologic sequelae were mostly cognitive, with minimal motor symptoms; the basis of this will require further study. Earlier identification of the specific viral pathogen may facilitate treatment with newer antiviral agents, such as pleconaril, which has been shown to have activity against a variety of entero-viruses and may improve neurologic outcome.19 However, the diagnosis of congenital infection is difficult to definitively establish. Direct in situ localization of viral protein and RNA in the placenta has not been previously reported in humans, although it has been reported in a mouse model of neonatal encephalitis.20 The latter study examined murine coxsackie virus infection (murine encephalomyelitis virus) of the placenta and did demonstrate by immunohistochemistry and in situ hybridization virus localization to the macrophages/monocytes.20 In this study, although viral RNA and protein primarily localized to the macrophage/monocyte and trophoblasts, the histologic and cytologic changes were not diagnostic per se of coxsackie virus infection. This is not surprising given that infections by RNA viruses at diverse sites, including the placenta, are often associated with nonspecific histologic findings.2,3,15,17 This underscores the value of molecular testing in such cases.
This study highlights the importance of histologic and viral testing of the placenta in all cases of substantial maternal or neonatal illness. This study shows that viral infections could be associated with several histologic findings in the placenta, all of which are nonspecific, ranging from focal to diffuse. Focal findings may require extensive sampling to be detected. Additionally, some findings linked to viral infections, such as villous sclerosis, perivillous fibrin deposition, and fibrin occlusion of vessels are nonspecific because they can be detected in the apparent absence of viral disease.2,3,10 Previous studies have demonstrated that viral DNA and RNA remain capable of being amplified in 10% of formalin-fixed tissues, such as placenta, for many years.15–17 Use of formalin-fixed tissues also presents advantages, such as viral inactivation, which would obviate a need for special precautions when working with potentially infectious viruses. Reverse transcriptase in situ PCR also offers the advantages of using specific and inexpensive oligoprimers that have a long shelf life as well as enhanced sensitivity. Therefore, viral infections may be initially overlooked because of the nonspecific histologic findings and detected years later by reverse transcriptase in situ PCR of placental tissue blocks to provide an explanation for severe neonatal disease and poor neurodevelopmental outcome. Clearly, this has important clinical and medical-legal implications.
This study provides direct evidence that placental infection with coxsackie virus does occur. It also provides indirect evidence that coxsackie virus infection of the fetus acquired in utero caused the global and severe developmental delays that each child exhibited, although direct infection by the virus of neurons was shown in one case. Animal models examining viral infection of the placenta by coxsackie virus has documented central nervous system-related disease in the neonate, which provides additional supportive evidence.20 Further study will be needed to address the issue. However, the absence of detectable coxsackie virus or other infectious agents with an in situ PCR-based methodology may allow the clinician to eliminate important causes of poor neonatal outcome.
|
Footnotes |
|---|
Received June 7, 2001. Received in revised form August 20, 2001. Accepted August 30, 2001.
|
REFERENCES |
|---|
|
TOP
ABSTRACTMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
2. Garcia AG, Marques RL, Lobato YY, Fonseca ME, Wigg MD. Placental pathology in congenital rubella. Placenta 1985;6:281–95.[Medline]
3. Sachdev R, Nuovo GJ, Kaplan C, Greco MA. Detection of CMV in chronic placentitis by in situ hybridization. Pediatr Pathol 1990;10:909–17.[Medline]
4. Amstey MS, Miller RK, Menegus MA, di Sant Agnese PA. Enterovirus in pregnant women and the perfused placenta. Am J Obstet Gynecol 1988;158:775–82.[Medline]
5. Strong BS, Young SA. Intrauterine coxsackie virus, group B type I, infection: Viral cultivation from amniotic fluid in the third trimester. Am J Perinatol 1995;12:78–9.[Medline]
6. Axelsson C, Bondestam K, Frisk G, Bergstrom S, Diderholm H. Coxsackie B virus infections in women with miscarriage. J Med Virol 1993;39:282–5.[Medline]
7. Frisk G, Diderholm H. Increased frequency of Coxsackie B virus IgM in women with spontaneous abortion. J Infect 1992;24:141–5.[Medline]
8. Basso NG, Fonseca ME, Garcia AG, Zuardi JA, Silva MR, Outani H. Enterovirus isolation from foetal and placental tissues. Acta Virol 1990;34:49–57.[Medline]
9. Feldman RG, Bryant J, Ives KN, Hill NC. A novel presentation of Coxsackie B2 virus infection during pregnancy. J Infect 1987;15:73–6.[Medline]
10. Batcup G, Holt P, Hambling MH, Gerlis LM, Glass MR. Placental and fetal pathology in Coxsackie virus A9 infection: A case report. Histopathology 1985;9:1227–35.[Medline]
11. Richardson J. Suspected transplacental coxsackie infection. Lancet 1977;ii:877–8.
12. Estes ML, Rorke LB. Liquefactive necrosis in Coxsackie B encephalitis. Arch Pathol Lab Med 1986;110:1090–2.[Medline]
13. Carthy CM, Yang D, Anderson DR, Wilson JE, McManus BM. Myocarditis as systemic disease: New perspectives on pathogenesis. Clin Exp Pharmacol Physiol 1997; 12:997–1003.
14. Hilton DA, Variend S, Pringle JH. Demonstration of coxsackie virus RNA in formalin fixed tissue sections from childhood myocarditis cases by in situ hybridization and the polymerase chain reaction. J Pathol 1993;170:45–51.[Medline]
15. Nuovo GJ, Gallery F, MacConnel P, Braun A. In situ detection of PCR-amplified HIV-1 nucleic acids and tumor necrosis factor RNA in the central nervous system. Am J Pathol 1994;144:659–66.[Abstract]
16. Nuovo GJ. PCR in situ hybridization: Protocols and applications. 3rd ed. New York, NY: Lippincott-Raven Press, 1997.
17. Nuovo GJ. Histologic distribution of hepatitis A, B, C, D, E, and G with concomitant cytokine response in liver tissue. Diagn Molec Pathol 1998;7:267–75.[Medline]
18. Severini GM, Mestroni L, Falaschi A, Camerini F, Giacca M. Nested polymerase chain reaction for high sensitivity detection of enteroviral RNA in biological samples. J Clin Microbiol 1993;31:1345–9.
19. Pevear DC, Tull TM, Seipel ME, Groarke JM. Activity of pleconaril against enteroviruses. Antimicrob Agents Chemother 1999;43:2109–15.
20. Abzug MJ. Characterization of the placental barrier to murine enterovirus infection. Placenta 1995;16:207–19.[Medline]
21. Parry S, Holder J, Strauss JF. Mechanisms of trophoblastvirus interaction. J Reprod Immunol 1997;37:25–34.[Medline]
This article has been cited by other articles:
|
|
 |
|
  C. J. McIver, C. F. H. Jacques, S. S. W. Chow, S. C. Munro, G. M. Scott, J. A. Roberts, M. E. Craig, and W. D. Rawlinson Development of Multiplex PCRs for Detection of Common Viral Pathogens and Agents of Congenital Infections J. Clin. Microbiol., October 1, 2005; 43(10): 5102 - 5110. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Feuer, R. R. Pagarigan, S. Harkins, F. Liu, I. P. Hunziker, and J. L. Whitton Coxsackievirus Targets Proliferating Neuronal Progenitor Cells in the Neonatal CNS J. Neurosci., March 2, 2005; 25(9): 2434 - 2444. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Feuer, I. Mena, R. R. Pagarigan, S. Harkins, D. E. Hassett, and J. L. Whitton Coxsackievirus B3 and the Neonatal CNS: The Roles of Stem Cells, Developing Neurons, and Apoptosis in Infection, Viral Dissemination, and Disease Am. J. Pathol., October 1, 2003; 163(4): 1379 - 1393. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. L. Goldenberg The Plausibility of Micronutrient Deficiency in Relationship to Perinatal Infection J. Nutr., May 1, 2003; 133(5): 1645S - 1648. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
