| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
ORIGINAL RESEARCH |
From the Departments of Obstetrics and Gynecology, and Therapeutic Radiology, Yale University School of Medicine, New Haven, Connecticut.
Address reprint requests to: Gil Mor, MD, PhD Yale University School of Medicine Department of Obstetrics and Gynecology 333 Cedar Street, FMB 202 New Haven, CT 06520 E-mail: gil.mor{at}yale.edu
 |
Abstract |
|---|
Top
 Abstract Materials and MethodsResultsDiscussionReferences |
|---|
and ERß mRNA and protein in normal ovarian tissue and primary and metastatic tumors.
Methods: Estrogen receptor and ERß expression was studied in normal ovarian biopsies (n = 9) and primary (n = 8) and metastatic ovarian epithelial cancers (n = 8). Ovarian tissue was collected from surgical samples. Estrogen receptor and ERß mRNA expression was compared by coamplification of the mRNA of the ERs. Expression was confirmed at the protein level by Western blot analysis using antibodies specific for each receptor.
Results: Among eight primary ovarian cancer samples, three had only ER, two had only ERß, and three had both. All eight metastatic ovarian cancer tissues expressed only ER mRNA and protein. Biopsies from normal ovaries had ER and ERß mRNA and protein. Two of the ovarian epithelial cancer samples were paired and showed the same results.
Conclusion: We found varying amounts of ER and ERß in normal ovaries, lower levels of ERß expression in ovarian epithelial cancer primary tumors, and only ER in metastatic tumors. Our findings indicate that a fundamental difference might exist between primary and metastatic cells, which could be caused by intrinsic or extrinsic factors that regulate ER gene expression.
Epithelial ovarian cancer is the fourth most common cause of death from cancer in women and the most lethal of gynecologic neoplasms.1,2 Despite intensive clinical and experimental research, the etiology of ovarian cancer remains poorly defined. Epidemiologic data suggest that steroid hormones might be involved in its genesis and progression.3 Normal ovaries express estrogen receptors (ER and ERß) in various cellular components and surface epithelium.4 Estrogen receptor is expressed in benign tumors and up to 60% of epithelial ovarian cancers5,6; however, experimental and clinical studies have not provided insight into the effect of ERs in ovarian carcinogenesis and tumor progression.
Despite considerable progress in prolonging survival with combination chemotherapy, the long-term prognosis for women with ovarian carcinoma remains dismal.1,2 Although normal ovarian epithelial cells and some ovarian epithelial cancer cells bind estrogen, only infrequently has treatment with anti-estrogens, such as tamoxifen, shown any beneficial clinical response.7 Until now, levels of sex hormone receptors in ovarian epithelial cancer cells have furnished little prognostic value and are poor predictors of response to hormones.
At present, two ERs have been identified, designated as ER and ERß.8 In normal rat ovaries, ERß is the predominant estrogen receptor.4 Also ERß is the predominant receptor in human fetal ovaries,9 with human granulosa cells from ovarian follicles expressing ERß mRNA exclusively. Estrogen receptor ß transcripts recently were found in benign and malignant ovarian epithelial cancer cells10–12 and in primary cultures of normal human ovarian surface epithelial cells.13 Whether the levels of expression of ER and ERß are altered after neoplastic transformation has not been reported.
In a previous study, we showed that estrogen induces cellular proliferation and protects neurons from apoptosis in the presence of ER, whereas ERß mediates estrogen-induced apoptosis.14 To evaluate the potential role of ER in ovarian cancer, we analyzed the relative expression of ER and ERß mRNA and protein in normal ovarian tissue and primary and metastatic tumors. We report here the lack of ERß expression in metastatic ovarian cancer.
|
Materials and Methods |
|---|
|
Top
AbstractMaterials and MethodsResultsDiscussionReferences |
|---|
). Total RNA was prepared as described15 and reverse transcribed into cDNA using the First Strand cDNA Synthesis Kit (Pharmacia Biotech, Piscataway, NJ) according to the manufacturer’s instructions. Then 7 µL of cDNA was put in a reaction mix for polymerase chain reaction (PCR). The primers used were ER—forward: 5'AATTCTGACAATCGACGCCAG3', reverse: 5'GTGCTTCAACATTCTCCCTCCTC3' for 30 cycles at 94C for 30 seconds, 57C for 30 seconds, and 72C for 1 minute; ERß—forward: 5'TGCTTTGGTTTGGGTTGATTGC3', reverse: 5'TTTGCTTTTACTGTCCTCTGC3' for 30 cycles at 94C for 30 seconds, 58C for 30 seconds, and 72C for 1 minute. Parallel PCRs using primers specific for the housekeeping gene, ß-actin (forward: 5'TACAACCTCCTTGCAGCTCC3'; reverse: 5'GGATCTTCATGAGGTAGTCAGTC3' for 30 cycles at 94C for 30 seconds, 60C for 30 seconds, and 72C for 1 minute), were run on the same cDNA samples.
|
:ERß expression we also amplified both receptors in the same sample using one primer common to both and one specific for each. This principle has been described previously.11 The primers used were ER/ERß sense: 5'-AAGAGCTGCCAGGCCTGCC-3'; ER anti-sense: 5'-TTGGCAGCTCTCATGTCTCC-3' and for ERß anti-sense: 5'-GCGCACTGGGGCGGCTGATCA-3', for 25 cycles at 94C for 30 seconds, 62C for 30 seconds, and 72C for 1 minute. Electrophoresis was done on the amplified PCR products on a 1–2% agarose gel and viewed with ethidium bromide (2 µg/70–mL gel) under ultraviolet light. Images of gels were put into a computer with a video camera (Eagle Eye, Fotodyne, Hartland, WI). The resulting digitized images were used for densitometric analysis of the appropriate bands. The intensity of each band was normalized against its corresponding ß-actin band to compare values between samples.
Total cellular protein was extracted from the organic phase of the RNA preparation using TRIzol Reagent (Life Technologies, Gaithersburg, MD) according to the manufacturer’s instructions. Protein concentrations were measured by BCA Protein Assay (Pierce, Rockford, IL), according to the manufacturer’s instructions. Proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis then transferred to nitrocellulose membranes. The membranes were incubated with primary antibody for the indicated times (ER—NCL-ER-611 [Novocastra; 1:50; 4 hours], ERß—Ab-1 [Calbiochem, New York, NY; 1:500; 1 hour]), washed with phosphate buffered saline-Tween, and incubated with the appropriate horseradish peroxidase (HRP)-conjugated secondary antibody (HRP-horse-anti-mouse [Vector, Burlingame, CA; 1:10,000; 1 hour] or HRP goat-anti-rabbit [Vector; 1:10,000; 1 hour]). The antibodies were viewed by developing them with the TMB Peroxidase substrate kit (Vector). The intensity of the bands was analyzed by densitometry and standardized against the total amount of protein present in the gel after staining with Coomassie blue using a digital imaging analysis system (AlphaEase, Alpha Innotech Corporation, San Leandro, CA). Statistical calculations were performed using the Statistical Package for Social Sciences (SPSS, Chicago, IL).
|
Results |
|---|
|
Top
AbstractMaterials and MethodsResultsDiscussionReferences |
|---|
and ß ERs, corresponding to nucleotides 702–720 in the ER gene and nucleotides 454–472 of the ERß gene. The specific 3' anti-sense primer for ER was located at nucleotides 850–869 and for ERß at nucleotides 701–721.
Normal ovarian tissue expresses both ER and ERß, but ERß is the predominant subtype. Quantification of the ER:ERß mRNA ratio showed an approximate 1:2 relationship. When we analyzed ER expression further in primary ovarian tumors, there was high variation in the ER mRNA expression and ratio between different samples. Three of eight cases expressed ER and ERß, although the level of expression for ER was higher than ERß. Two primary tumors expressed only ER, and two had only ERß (Table 1
and Figure 1). Metastatic tumors expressed only ER mRNA, completely absent of ERß mRNA. One case had expression of ER and ERß, although the ERß mRNA level was markedly lower than the ER level (data not shown). However, according to the pathologic diagnostic report, that sample was heterologous malignant mixed Müllerian tumor.
|
and ERß proteins were expressed in human ovarian tissues, proteins extracted from the same cases were analyzed by western blot analysis using a monoclonal antibody for ER (clone NCL-ER-6F11, Novo Castra Laboratories, Claremont Place, UK) and a polyclonal antibody for ERß (clone AB-1, Oncogene Research Products, Cambridge, MA). Western blot analysis found results similar to those of the RNA. Thus, ER and ERß were present in normal ovaries and primary tumors. Metastatic ovarian tumors were characterized by the expression of high levels of only ER protein and the complete absence of ERß (Figure 2). Normal human endometrium was included as a positive control for ER. Normal endometrium expresses high levels of ER and low levels of ERß (Figure 2).
|
|
Discussion |
|---|
|
Top
AbstractMaterials and MethodsResultsDiscussionReferences |
|---|
and ERß, which agreed with studies that showed ER mRNA expressed at a lower level than ERß mRNA.4,16 The cellular distribution of ERß in humans and rodents has been primarily in granulosa cells of small growing and preovulatory follicles, whereas ER is distributed throughout normal ovaries.4 Recently, the ER status of normal ovarian surface epithelium showed ER and ERß. Most ovarian cancer is presumed to originate in ovarian surface epithelium, and 62.5% of the studied ovarian epithelial tumors expressed ERß, so the complete absence of ERß expression in metastatic ovarian epithelial tumors could be a characteristic of metastatic transformation. Another possibility is that cells that express ERß cannot survive in metastatic ovarian epithelial cancer.
The ER is translated from a 6.8-kb mRNA that contains eight exons derived from a gene on the long arm of chromsome 6 and has a molecular weight of about 66,000 daltons with 595 amino acids. The more recently discovered ERß is encoded by a gene localized to chromosome 14q22-q24, near genes related to Alzheimer disease,17 and that encodes nine to ten differently sized ERß isoforms in the range of 485, 503, and 530 amino acids.17,18 The affinity for the 17ß-estradiol (E2) and other known ER ligands varied between ER and the different ERß isoforms.19 Although they respond in a comparable manner to the same hormones, there are differences; for example, phytoestrogens have a greater affinity for ERß than ER. Whether all the ERß isoforms will have significant biologic and physiologic effects is undetermined.
The ERs are divided into six regions in five domains, labeled A to F. The ERß is 97% homologous in amino acid sequence with ER in the DNA-binding domain and 59% homologous in the hormone-binding domain.20 The N-terminal is the most varied, whereas the C-terminal is the most conserved sequence in those receptors. Estrogen receptor contains several phosphorylation sites in the AB region and the transcription activation function called TAF-1. Because the regulatory domains differ in the two receptors, ERß might be incapable of activating gene transcription by means of TAF-1, which is either significantly modified or absent. Thus, ER has E2-dependent activation of transcription, whereas E2-liganded ERß had no effect or inhibited antiestrogen-dependent stimulation.21 Estrogen receptor and ERß can form / or ß/ß homodimers as well as /ß heterodimers upon binding to the estrogen-recognizing elements22 adding further complexity to the regulation of gene expression in cells that express both receptors. Depending on whether the complex is a homodimer or a heterodimer, it can bind to other DNA sites than the estrogen-recognizing elements, eg, to the AP-1 response elements by the AP-1 proteins jun and fos.19 At that site, E2 binding to ER stimulates transcription and ERß inhibits it.19
Our work showed high variation in ER expression in primary ovarian tumors, with a predominant characteristic change in the ER:ERß ratio showing a higher level of ER than ERß compared with normal ovarian epithelium (Table 1). Further, we found an absence of ERß expression at the mRNA and protein levels in metastatic ovarian tumors. These results, together with previous studies, provide strong evidence for an essential effect of the ER type in regulation of transformation and metastasis of epithelial ovarian cancer.
Estrogen receptor expression has been studied extensively in ovarian cancer to correlate it to clinical behavior and prognosis. Despite that, no clear relationship between ER expression and tumor histology, patient age, or outcome has been noted in epithelial tumors.23 Of particular interest to normal ovarian physiology and malignant transformation is our observation that malignant tissues of epithelial origin expressed substantially higher levels of ER and not ERß. Recent studies showed that the relative levels of ER and ERß are important determinants of biologic response to ER agonists in specific target tissues and could be important determinants of pharmacology of antiestrogens.24 We have shown that estrogen induces apoptosis in neuron-like cells that express ERß, but induces cell growth and proliferation in similar cells that express ER and ERß.14 A lack of ERß in malignant ovarian tissue could indicate resistance to inhibitory pathways.
In the primary ovarian tumors analyzed, we found a wide range of phenotypic ER expression, with decreasing levels of ERß expression as the only common denominator. Those findings have two important implications, namely, that the balance between ER and ERß receptors might be imperative to maintain normal cellular function, and that as the level of the ERß decreases, uncontrolled cellular proliferation leads to a metastatic state. Therefore, ER status could be used as a prognostic marker of ovarian carcinogenesis. Our findings suggest a fundamental biologic difference between primary and metastatic ovarian epithelial cancer cells that could be caused by intrinsic or extrinsic factors regulating gene expression. Understanding them might give us insight to carcinogenesis, metastatic behavior, and effects of treatment.
|
Footnotes |
|---|
Received January 4, 2000. Received in revised form March 9, 2000. Accepted April 7, 2000.
|
References |
|---|
|
Top
AbstractMaterials and MethodsResultsDiscussionReferences |
|---|
2. Parker SL, Davis KJ, Wingo PA, Ries LA, Heath CW Jr. Cancer statistics by race and ethnicity. CA Cancer J Clin 1998;48:31–48.[Abstract]
3. Parker SL, Tong T, Bolden S, Wingo PA. Cancer statistics, 1996. CA Cancer J Clin 1996;46:5–27.[Abstract]
4. Byers M, Kuiper GG, Gustafsson JA, Park-Sarge OK. Estrogen receptor-beta mRNA expression in rat ovary: Down-regulation by gonadotropins. Mol Endocrinol 1997;11:172–82.
5. Schwartz PE, LiVolsi VA, Hildreth N, MacLusky NJ, Naftolin FN, Eisenfeld AJ. Estrogen receptors in ovarian epithelial carcinoma. Obstet Gynecol 1982;59:229–38.
6. Clinton GM, Hua W. Estrogen action in human ovarian cancer. Crit Rev Oncol Hematol 1997;25:1–9.[Medline]
7. Schwartz PE, Chambers JT, Kohorn EI, Chambers SK, Weitzman H, Voynick IM, et al. Tamoxifen in combination with cytotoxic chemotherapy in advanced epithelial ovarian cancer. A prospective randomized trial. Cancer 1989;63:1074–8.[Medline]
8. Warner M, Nilsson S, Gustafsson JA. The estrogen receptor family. Curr Opin Obstet Gynecol 1999;11:249–54.[Medline]
9. Kuiper GG, Carlsson B, Grandien K, Enmark E, Haggblad J, Nilsson S, et al. Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptors alpha and beta. Endocrinology 1997;138:863–70.
10. Lau KM, Mok SC, Ho SM. Expression of human estrogen receptor-alpha and -beta, progesterone receptor, and androgen receptor mRNA in normal and malignant ovarian epithelial cells. Proc Natl Acad Sci U S A 1999;96:5722–7.
11. Pujol P, Rey JM, Nirde P, Roger P, Gastaldi M, Laffargue F, et al. Differential expression of estrogen receptor-alpha and beta messenger RNAs as a potential marker of ovarian carcinogenesis. Cancer Res 1998;58:5367–73.
12. Mosselman S, Polman J, Dijkema R. ER beta: Identification and characterization of a novel human estrogen receptor. FEBS Lett 1996;392:49–53.[Medline]
13. Hillier SG, Anderson RA, Williams AR, Tetsuka M. Expression of oestrogen receptor alpha and beta in cultured human ovarian surface epithelial cells. Mol Hum Reprod 1998;4:811–5.
14. Nilsen J, Mor G, Naftolin F. Estrogen-regulated developmental neuronal apoptosis is determined by estrogen receptor subtype and Fas/Fas ligand system. J Neurobiol 2000;43:64–78.[Medline]
15. Mor G, Gutierrez L, Eliza M, Kahyaoglu F, Arici A. Fas-Fas ligand system induced apoptosis in human placenta and gestational trophoblastic disease. Am J Reprod Immunol 1998;40:89–95.
16. Brandenberger AW, Tee MK, Jaffe RB. Estrogen receptor alpha (ER-alpha) and beta (ER-beta) mRNAs in normal ovary, ovarian serous cystadenocarcinoma and ovarian cancer cell lines: Down-regulation of ER-beta in neoplastic tissues. J Clin Endocrinol Metab 1998;83:1025–8.
17. Kuiper GGJM, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JA. Cloning of a novel estrogen receptor expressed in rat prostate and ovary. Proc Natl Acad Sci U S A 1996;93:5925–30.
18. Kuiper GGJM, Gustafsson JA. The novel estrogen receptor-ß subtype: Potential role in the cell- and promoter-specific actions of estrogens and anti-estrogens. FEBS Lett 1996;410:87–90.
19. Paech K, Webb P, Kuiper G, Nilsson S, Gustafsson J, Kushner PJ, et al. Differential ligand activation of estrogen receptors ER and ERß at AP1 sites. Science 1997;277:1508–10.
20. Evans RM. The steroid and thyroid hormone receptor superfamily. Science 1988;240:889–95.
21. Berry M, Metzger D, Chambon P. Role of the two activating domains of the oestrogen receptor in the cell-type and promoter-context dependent agonistic activity of the anti-oestrogen 4-hydroxytamoxifen. EMBO J 1990;9:2811–8.[Medline]
22. Cowley SM, Parker MG. A comparison of transcriptional activation by ER alpha and ER beta. J Steroid Biochem Mol Biol 1999;69:165–75.[Medline]
23. Hildreth NG, Kelsey JL, LiVolsi VA, Fisher DB, Holford TR, Mostow ED, et al. An epidemiologic study of epithelial carcinoma of the ovary. Am J Epidemiol 1981;114:398–405.
24. Hall JM, McDonnell DP. The estrogen receptor beta-isoform (ER-beta) of the human estrogen receptor modulates ERalpha transcriptional activity and is a key regulator of the cellular response to estrogens and antiestrogens. Endocrinology 1999;140:5566–78.
This article has been cited by other articles:
|
|
 |
|
  R. Dip, S. Lenz, J.-P. Antignac, B. Le Bizec, H. Gmuender, and H. Naegeli Global gene expression profiles induced by phytoestrogens in human breast cancer cells Endocr. Relat. Cancer, March 1, 2008; 15(1): 161 - 173. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Leigh Pearce, A. M. Near, J. L. Butler, D. Van Den Berg, P. Bretsky, D. V. Conti, D. O. Stram, M. C. Pike, J. N. Hirschhorn, and A. H. Wu Comprehensive Evaluation of ESR2 Variation and Ovarian Cancer Risk Cancer Epidemiol. Biomarkers Prev., February 1, 2008; 17(2): 393 - 396. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Cho, M. K. Lee, K.-H. Nam, W. Y. Chung, C. S. Park, J. H. Lee, T. Noh, W. I. Yang, Y. Rhee, S.-K. Lim, et al. Expression and role of estrogen receptor {alpha} and {beta} in medullary thyroid carcinoma: different roles in cancer growth and apoptosis J. Endocrinol., November 1, 2007; 195(2): 255 - 263. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Treeck, G. Pfeiler, D. Mitter, C. Lattrich, G. Piendl, and O. Ortmann Estrogen receptor {beta}1 exerts antitumoral effects on SK-OV-3 ovarian cancer cells J. Endocrinol., June 1, 2007; 193(3): 421 - 433. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. C.K. Leung and J.-H. Choi Endocrine signaling in ovarian surface epithelium and cancer Hum. Reprod. Update, March 1, 2007; 13(2): 143 - 162. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. J M O'Donnell, K. G Macleod, D. J Burns, J. F Smyth, and S. P Langdon Estrogen receptor-{alpha} mediates gene expression changes and growth response in ovarian cancer cells exposed to estrogen Endocr. Relat. Cancer, December 1, 2005; 12(4): 851 - 866. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C Roger, S Lambard, A Bouskine, B Mograbi, D Chevallier, M Nebout, G Pointis, S Carreau, and P Fenichel Estrogen-induced growth inhibition of human seminoma cells expressing estrogen receptor {beta} and aromatase J. Mol. Endocrinol., August 1, 2005; 35(1): 191 - 199. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Lukanova and R. Kaaks Endogenous Hormones and Ovarian Cancer: Epidemiology and Current Hypotheses Cancer Epidemiol. Biomarkers Prev., January 1, 2005; 14(1): 98 - 107. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. H. Herynk and S. A. W. Fuqua Estrogen Receptor Mutations in Human Disease Endocr. Rev., December 1, 2004; 25(6): 869 - 898. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. M. Selva, O. M. Tirado, N. Toran, C. A. Suarez-Quian, J. Reventos, and F. Munell Estrogen Receptor {beta} Expression and Apoptosis of Spermatocytes of Mice Overexpressing a Rat Androgen-Binding Protein Transgene Biol Reprod, November 1, 2004; 71(5): 1461 - 1468. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A Bardin, N Boulle, G Lazennec, F Vignon, and P Pujol Loss of ER{beta} expression as a common step in estrogen-dependent tumor progression Endocr. Relat. Cancer, September 1, 2004; 11(3): 537 - 551. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Bardin, P. Hoffmann, N. Boulle, D. Katsaros, F. Vignon, P. Pujol, and G. Lazennec Involvement of Estrogen Receptor {beta} in Ovarian Carcinogenesis Cancer Res., August 15, 2004; 64(16): 5861 - 5869. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. M. Tirado, D. M. Selva, N. Toran, C. A. Suarez-Quian, M. Jansen, D. P. McDonnell, J. Reventos, and F. Munell Increased Expression of Estrogen Receptor {beta} in Pachytene Spermatocytes After Short-Term Methoxyacetic Acid Administration J Androl, January 1, 2004; 25(1): 84 - 94. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. F. Verschraegen, W. Hu, Y. Du, J. Mendoza, J. Early, M. Deavers, R. S. Freedman, R. C. Bast Jr., A. P. Kudelka, J. J. Kavanagh, et al. Establishment and Characterization of Cancer Cell Cultures and Xenografts Derived from Primary or Metastatic Mullerian Cancers Clin. Cancer Res., February 1, 2003; 9(2): 845 - 852. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Sapi, W. D. Brown, S. Aschkenazi, C. Lim, A. Munoz, B. M. Kacinski, T. Rutherford, and G. Mor Regulation of Fas Ligand Expression By Estrogen in Normal Ovary Reproductive Sciences, July 1, 2002; 9(4): 243 - 250. [Abstract] [PDF]
|
|
|
|
 |
|
 G. Lazennec, D. Bresson, A. Lucas, C. Chauveau, and F. Vignon ER{beta} Inhibits Proliferation and Invasion of Breast Cancer Cells Endocrinology, September 1, 2001; 142(9): 4120 - 4130. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
