Obstetrics & Gynecology Email Alerts
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Obstetrics & Gynecology 2006;108:141-147
© 2006 by The American College of Obstetricians and Gynecologists
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Erratum (v108,p695)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sheffield, J. S.
Right arrow Articles by Wendel, G. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sheffield, J. S.
Right arrow Articles by Wendel, G. D., Jr
Related Collections
Right arrow Infectious disease
Right arrow Medical complications of pregnancy

ORIGINAL RESEARCH

Valacyclovir Prophylaxis to Prevent Recurrent Herpes at Delivery

A Randomized Clinical Trial

Jeanne S. Sheffield, MD1, James B. Hill, MD1, Lisa M. Hollier, MD1, Vanessa R. Laibl, MD1, Scott W. Roberts, MD1, Pablo J. Sanchez, MD2 and George D. Wendel, Jr, MD1

From the Departments of 1Obstetrics & Gynecology and 2Pediatrics, University of Texas Southwestern Medical Center at Dallas, Dallas, Texas.


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
OBJECTIVE: To measure the efficacy of valacyclovir suppression in late pregnancy to reduce the incidence of recurrent genital herpes in labor and subsequent cesarean delivery.

METHODS: A total of 350 pregnant women with a history of genital herpes were assigned randomly to oral valacyclovir 500 mg twice a day or an identical placebo from 36 weeks of gestation until delivery. In labor, vulvovaginal herpes simplex virus (HSV) culture and polymerase chain reaction (PCR) specimens were collected. Vaginal delivery was permitted if no clinical recurrence or prodromal symptoms were present. Neonatal HSV cultures and laboratory tests were obtained, and infants were followed up for 1 month after delivery. Data were analyzed using {chi}2 and Student t tests.

RESULTS: One hundred seventy women treated with valacyclovir and 168 women treated with placebo were evaluated. Eighty-two percent of the women had recurrent genital herpes; 12% had first episode, nonprimary genital herpes; and 6% had first episode, primary genital herpes. At delivery, 28 women (8%) had recurrent genital herpes requiring cesarean delivery: 4% in the valacyclovir group and 13% in the placebo group (P = .009). Herpes simplex virus was detected by culture in 2% of the valacyclovir group and 24% of the placebo group (P =.02). No infants were diagnosed with neonatal HSV, and there were no significant differences in neonatal complications. There were no significant differences in maternal or obstetric complications in either group.

CONCLUSION: Valacyclovir suppression after 36 weeks of gestation significantly reduces HSV shedding and recurrent genital herpes requiring cesarean delivery.

LEVEL OF EVIDENCE: I


Genital herpes simplex virus (HSV) infection is one of the most common viral sexually transmitted diseases in the United States, now affecting an estimated 50 million adolescents and adults.1,2 Although only 5% to 10% of women of reproductive age have a history of genital herpes infection, 25% to 30% have HSV-2 antibodies.1,3–5 The majority of these seropositive women are unaware of their HSV infection. As the incidence of this sexually transmitted infection continues to rise, and because the greatest incidence of HSV infections occur in women of reproductive age, the risk of maternal transmission of the virus to the fetus or neonate has become a major health concern.

Almost 100% of women with HSV-2 experience clinical or subclinical recurrences throughout their lifetime,9 especially in the 8–10 years after primary infection.2 Five to 10% of pregnant women have symptomatic recurrent genital herpes during pregnancy,2,3 and up to 25% of these women will have an HSV outbreak the last month of pregnancy.10 Because 85% of neonatal herpes results from viral transmission near delivery,7,11 the pursuit of strategies to prevent transmission has focused on this period. Currently, it is recommended that a cesarean delivery be offered to all women with an active genital herpes lesion or prodromal symptoms at the time of presentation in labor.8 However, the observation that 70% of neonatal herpes cases occur in infants of women who asymptomatically shed virus near delivery4,11–14 has refocused attention to therapeutic approaches that decrease HSV viral shedding, regardless of clinical lesion status.

In a recent meta-analysis we found that prophylactic acyclovir beginning at 36 weeks of gestation reduced the risk of clinical HSV recurrence at delivery, cesarean delivery for recurrent genital herpes, and viral shedding at delivery.15 Valacyclovir hydrochloride, a prodrug of acyclovir, was developed to improve the bioavailability of acyclovir by enhancing absorption from the gastrointestinal tract. This allows for less frequent dosing requirements.16 In clinical trials that did not include pregnant women, it has been shown to be equally effective in suppressing episodes of recurrent genital herpes.

The purpose of this study was to estimate the efficacy of valacyclovir prophylaxis given from 36 weeks gestation until delivery in reducing clinical and virologic evidence of HSV infection at the time of delivery. We also sought to determine any adverse effects of valacyclovir in the neonate.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
This study was a prospective randomized, double-blind comparison of the efficacy of valacyclovir compared with placebo administered orally from 36 weeks gestation until delivery. An independent party was responsible for the randomization code and kept the study code records. It was conducted at Parkland Health and Hospital System in Dallas, Texas, which serves a predominantly indigent population, over a 6-year period from April 1, 1998, through November 2004. The study protocol was approved by the Institutional Review Board of the University of Texas Southwestern Medical Center at Dallas.

All pregnant women at 36 weeks of gestation or less who had a history of genital HSV antedating the pregnancy or who experienced a first outbreak of genital herpes during the pregnancy were approached regarding the study. An information pamphlet was provided in either English or Spanish. All eligible women had serologic confirmation of prior HSV infection by antibody testing using an HSV-1 and HSV-2 IgG enzyme-linked immunosorbent assay II kit (Wampole Laboratories, Cranburg, NJ). First episode primary genital herpes was diagnosed in women with a new genital lesion positive for HSV-1 or HSV-2 and seronegative for both. First episode nonprimary genital herpes was diagnosed when a genital lesion was positive for HSV-2 and seropositive for HSV-1 but seronegative for HSV-2. Women were excluded from the study if they were allergic to valacyclovir or acyclovir, had an immunosuppressive disorder such as human immunodeficiency virus, were known to require a cesarean section or were greater than 36 weeks of gestation at the time of identification. Women with a known fetal anomaly, intrauterine growth restriction, or oligohydramnios were also excluded.

Informed consent was obtained from eligible patients by 36 completed weeks of gestation. Assignment at 36 weeks was made using a computer-generated random number table. They were then dispensed either valacyclovir 500 mg or an identical-appearing placebo, to be taken 2 times a day until delivery. Patients, physicians, and the research coordinator were blinded to the assigned study regimen. An individual not involved with patient care maintained the randomization list and assigned the study drug groups.

Women were scheduled to return weekly to a specific sexually transmitted disease prenatal clinic staffed by the study investigators. At each visit, a detailed questionnaire was given regarding medication side effects, symptoms of a clinical recurrence or prodromal symptoms and medication adherence (by pill count). A pelvic examination for HSV lesions was performed and an HSV culture was obtained to evaluate any suspicious lesions or if prodromal symptoms were present. The study patients were then dispensed another week's supply of study medication.

On admission to the labor and delivery unit, each patient was examined for evidence of genital lesions by visual examination of external genitalia, vagina, and cervix using a speculum. They were questioned regarding prodromal symptoms by trained nurse-practitioners and physicians. An HSV culture of the usual lesion site and the cervix was performed to detect asymptomatic shedding. Visible genital or cervical lesions were also cultured. Another sample was collected using a polyester fiber swab from the above sites, air dried and stored at 4°C for DNA isolation and PCR analysis (described below) at a later date. Results of PCR analysis were not available to the managing clinicians. Women underwent cesarean delivery if they presented in active labor or with ruptured membranes with either a lesion suspicious for HSV or prodromal symptoms.

Each neonate was evaluated at 12–36 hours of age by a pediatrician aware of the mother's participation in the study but blinded to the study allocation. Under protocol, neonates did not receive prophylactic antiviral treatment for possible exposure at delivery. A physical examination was performed; HSV cultures of the newborn's conjunctiva, oropharynx, rectum, scalp electrode site, and any suspicious lesions were obtained. A polyester fiber swab was also obtained from these sites and stored at 4°C for DNA isolation and PCR analysis (described below). Due to reports of neutropenia in newborns exposed to high dose intravenously acyclovir,21,22 we included a nested substudy of neonatal safety in a group of 126 consecutive neonates to examine neonatal safety after in utero acyclovir exposure. Complete blood count with differential, liver function tests, serum creatinine, and urinalysis were performed. Mothers were instructed to contact investigators for any problems in the first month after discharge, and the infants were followed up at 1 month of age to assess any readmissions or adverse events.

Maternal and neonatal samples obtained for DNA analysis were air dried and stored at 4°C. They were then placed in 0.4 mL phosphate-buffered saline and incubated at room temperature for 30 minutes. After removal of the swab, the resulting patient sample (approximately 0.2 mL) was processed for DNA isolation using the QIAmp DNA Blood Mini Kit (QIAGEN Inc., Valencia, CA) according to the manufacturers' protocol for isolation of genomic DNA from buccal swabs. Final DNA sample volume was 0.15 mL. Quantification of HSV-2 by PCR was performed using the HHVQ-1 internal calibration standard (ICS), essentially as described. Briefly, PCR reactions contained 10-µL patient sample DNA, 20 molecules of HHVQ-1, 2.5 units of AmpliTaq DNA polymerase (Perkin-Elmer, Wellesley, MA), 60 mM Tris-HCl pH 9.0, 15 mM ammonium sulfate, 2 mM MgCl2, 20 mmol of each HSV-2 oligonucleotide primer (5'primer-cgtcctggagtttgacagcg; 3' primer – cagcagcgagtcctgcacacaa), and 100 µM each of dATP, dCRP, dGTP, and dUTP in 50 µL final volume. Amplification reactions were initially heated to 95°C for 2 minutes and then subjected to 36 cycles of 94°C for 0.5 minutes, 60°C for 0.5 minutes, and 72°C for 1 minute, followed by a final extension at 72°C for 9 minutes in a GeneAmp 9600 thermocycler (Perkin-Elmer). PCR products were separated by 2% agarose gel electrophoresis and quantified following staining with SyberGold (Molecular Probes, Eugene, OR) on a fluorimager (Typhon 8600, Amersham Biosciences, Piscataway, NJ) using ImageQuant software. Quantities of HSV-2 were determined by comparison of band intensities derived from the ICS and HSV-2, and are expressed as HSV-2 viral genomes (or viral targets)/patient sample. For patient samples with high levels of HSV-2, DNA samples were diluted in ddH2O before amplification such that roughly equivalent ICS and HSV-2 PCR product band intensities were obtained.

To verify the identity of any positive HSV-2-derived PCR products, DNA from the agarose gels was transferred to Zeta-Probe Blotting Membranes (Bio-Rad Laboratories, Hercules, CA) using a vacuum blot apparatus and an alkaline transfer buffer (0.5 M NaOH, 0.6 M NaCl). The blots were air dried and then prehybridized for 1 hour at room temperature in 10 mL of Hybridization Buffer (1% SDS, 1.5X SSPE, and 100 mg of nonfat dry milk). An HSV-2–specific oligonucleotide probe (ggcatcatcaccgacaaggtcaaactctccagc) was end-labeled with 1 µCi of [{gamma}32P]ATP using T4 polynucleotide kinase. The probe was denatured for 10 minutes at 95°C and then incubated with the filter for 4 hours at room temperature in 10 mL of fresh Hybridization Buffer. After hybridization, the filter was washed four times shaking for 15 minutes as follows: 2X SSC at room temperature (RT), 2X SSC and 0.1% SDS at RT, ol5 X SSC and 0.1% SDS at RT, 0.5 X SSC and 1% SDS at 37°C. The wet filter was placed in plastic wrap and exposed to a phosphorimager screen overnight. The screen was scanned and analyzed using a phosphorimager (Typhoon 8600). All positive PCR samples were confirmed using this procedure.

Sample size estimates were performed before the study onset using a power of 0.9 (type II error 0.10) and type I error of 0.05. We estimated a recurrence risk at delivery in the placebo group to be 17.9% (pooled estimate), and a recurrence risk at delivery in the valacyclovir group to be 4.9% (pooled estimate based on available acyclovir data). This yielded a minimum sample size of 139 women in each group. Anticipating a lost to follow-up rate of 5% and with the addition of the nested cohort study for neonatal safety, a total of 350 women were enrolled in the study.

Normally distributed continuous data were analyzed using a Student t test; a nonparametric Mann–Whitney U test was used for continuous data. A {chi}2 test was used to analyze categoric data, and odds ratios (ORs) with 95% confidence intervals (CIs) were calculated. Data were analyzed as intent to treat.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Three hundred fifty women were enrolled in the study, 178 in the valacyclovir group and 172 in the placebo group. A total of 12 women (3%) were lost to follow-up during the study period. The final study cohort consisted of 338 women, 170 in the valacyclovir group and 168 in the placebo group. Table 1 details the demographic and social characteristics of the two groups. There were no significant differences with regard to age, race, parity, and marital status. There were also no differences in tobacco, alcohol, or injection drug use.


View this table:
[in this window]
[in a new window]
 
Table 1. Demographic and Social Characteristics.

 

The majority of women had a history of a sexually transmitted disease or infection, excluding HSV (Table 2). The mean age at first HSV outbreak for the cohort was 21.7 ± 5.1 years (21.2 ± 5.1 years and 22.2 ± 5.1 years in the valacyclovir and placebo groups, respectively). Thirty-nine percent and 34% of the women in the valacyclovir and placebo groups, respectively, reported more than one HSV outbreak per year. All women had a clinical history and serologic confirmation of HSV infection. The majority of women were diagnosed with recurrent disease (79% and 84%, valacyclovir compared with placebo). Overall, 82% of the women had recurrent genital herpes; 12% had first episode, nonprimary genital herpes; 6% had first episode, primary genital herpes. There were no significant differences between the 2 groups with regard to HSV history (Table 2). Finally, medication compliance in the week before delivery was similar between the 2 groups (91% and 88% in the valacyclovir and placebo groups, respectively).


View this table:
[in this window]
[in a new window]
 
Table 2. Sexual and Herpes Simplex Virus History

 

The valacyclovir and placebo cohorts reported a similar number of HSV recurrences before the onset of study medication at 36 weeks (Table 3). Seventy-six women in the study had at least 1 HSV recurrence before randomization. Upon initiation of medication at 36 weeks, a significant decrease was noted in the median number of HSV recurrences per patient and in any HSV recurrence in those women receiving valacyclovir (P = .04 and P = .005, respectively).


View this table:
[in this window]
[in a new window]
 
Table 3. Herpes Simplex Virus Outbreaks During the Antepartum Period

 

Valacyclovir significantly reduced the number of women with clinical genital HSV at delivery by 70%, from 13% in the placebo group to 4% in the valacyclovir group (P = .009; OR .30, 95% CI .12–.73) (Table 4). Two hundred fifty-five women had an HSV culture performed at delivery, and 164 women had PCR data available for analysis. Valacyclovir significantly decreased the likelihood of a positive culture or PCR result (P = .02 and 0.01, respectively; OR .18, 95% CI .04–.82 and OR .28, 95% CI .11–.72, respectively). Finally, valacyclovir decreased the number of cesarean deliveries performed for HSV, from 13% in the placebo group to 4% in the valacyclovir group (P = .009; OR .3 95% CI .12–.73).


View this table:
[in this window]
[in a new window]
 
Table 4. Herpes Simplex Virus Status at Delivery

 

There were no significant differences between the 2 groups with regard to estimated gestational age at delivery or mean birthweight (Table 5). There were also no differences between the 2 groups with regard to obstetric and neonatal complications, such as meconium-stained amniotic fluid, neonatal sepsis, and ventilation requirements, and admission to the neonatal intensive care unit. No infant had a positive HSV culture at birth.


View this table:
[in this window]
[in a new window]
 
Table 5. Delivery and Neonatal Outcomes

 

One hundred twenty-six infants were enrolled in the nested substudy to evaluate the safety of valacyclovir, 66 in the valacyclovir group and 60 in the placebo group. Toxicity assessments were quantitated using the Division of Acquired Immunodeficiency Syndrome (DAIDS) Toxicity Tables for neonatal laboratory results.26 No infant was diagnosed with neutropenia defined by either a total white cell count less than 4,000 cells/mm3 or an absolute neutrophil count less than 1,000/mm3. There was no significant increase in the number of infants diagnosed with anemia. There was only 1 infant in the valacyclovir group with a hemoglobin less than 10 g% (actual value 9.2 g%). There were no adverse hepatic or renal effects noted when the neonate was exposed to valacyclovir (Table 6).


View this table:
[in this window]
[in a new window]
 
Table 6. Laboratory Evaluation in the Nested Substudy on Neonatal Safety

 

Adverse events were collected during the study period. There was 1 unexplained fetal demise at term in the placebo group. No evidence of HSV was noted in this infant. There were no major congenital malformations noted in either cohort, and only 1 minor malformation in the placebo group (polydactyly). Finally, 1 neonate in each group was readmitted to the hospital to evaluate neonatal sepsis. No infant was diagnosed with neonatal HSV in the first month of life.

Valacyclovir was tolerated well in the study cohort. There was no serious morbidity in either group. Seven (4%) women compared with 5 (3%) women in the valacyclovir and placebo groups, respectively, experienced mild nausea and vomiting. Headache or dizziness was reported in 8% of the women, with no difference between valacyclovir and placebo groups.


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We report a large randomized placebo-controlled trial comparing valacyclovir to placebo suppression in pregnancy from 36 weeks until delivery. Valacyclovir decreased the rate of clinical HSV at delivery by 69%. It also decreased asymptomatic shedding at delivery, shown using HSV culture and PCR. A decrease in cesarean delivery for HSV was noted. There was no significant increase in adverse obstetric or neonatal events in the valacyclovir group. Neonatal laboratory evaluation showed no neutropenia and no hepatic or renal dysfunction in infants exposed to valacyclovir. Finally, valacyclovir was tolerated well by pregnant women with only minor side effects, comparable to the placebo group.

Valacyclovir suppression has been shown in adults to decrease recurrent genital HSV, asymptomatic shedding, and HSV transmission18–20,27 comparable to previously reported acyclovir data. The benefits of valacyclovir hydrochloride are 2-fold. It is rapidly absorbed from the gastrointestinal tract with improved bioavailability. It is also rapidly converted to acyclovir and achieves higher plasma levels than acyclovir alone.28 This allows for less frequent dosing, potentially improving patient compliance. Valacyclovir is well tolerated and adverse events reported have been mild. The experience was similar in our cohort, with no increase in maternal side effects compared with placebo.

The benefit of treating pregnant women with a history of HSV with suppressive antiviral therapy has been controversial. The American College of Obstetricians and Gynecologists (ACOG) recommendations are based on limited or inconsistent scientific evidence (level B) or on consensus and expert opinion (level C). The ACOG Practice Bulletin of October 1999 states, "For women at or beyond 36 weeks of gestation with a first episode of HSV during the current pregnancy, antiviral therapy should be considered" (level B) and "For women at or beyond 36 weeks of gestation who are at risk for recurrent HSV, antiviral therapy also may be considered, although such therapy may not reduce the likelihood of cesarean delivery (level C). We recently performed a meta-analysis of the 5 randomized controlled trials evaluating acyclovir suppression in pregnant women with a history of genital HSV.15 Acyclovir suppression was found to be effective in reducing the risk of both clinical genital herpes recurrences and HSV shedding at delivery. The results of this study confirm these findings about antiviral suppression and extend them to include valacyclovir.

A concern with the use of antiviral prophylaxis has been that suppression of viral shedding might be incomplete. In other words, a reduction in the rate of cesarean delivery could theoretically increase the risk of neonatal herpes by increasing vaginal deliveries and genital tract exposure to subclinical HSV shedding. The data from this study and the previously described meta-analysis15 indicate that antiviral prophylaxis is effective in reducing the risk of active lesions and in reducing the risk of asymptomatic shedding.

Some investigators have expressed concerns about the effect of valacyclovir on the fetus and neonate. In two studies by Kimberlin et al21,22 neutropenia, defined as an absolute neutrophil count less than 1,000/mm,3 was noted in 21% of infants with neonatal HSV treated with prolonged intravenous acyclovir and in 46% treated with prolonged suppressive oral acyclovir. These safety concerns led us to initiate a nested substudy, evaluating neonatal safety laboratory studies and scheduling a one-month follow-up examination. Although the numbers of exposed infants is limited, no neutropenia was noted in either study group. Furthermore, valacyclovir did not have an adverse effect on liver or renal function. No neonate had anemia that required blood transfusion. We did not observe any association with congenital malformations, but infants were not exposed to the drug until 36 weeks of gestation.

This study was powered sufficiently to address the primary outcomes. However, there are several limitations. The delivery collection of HSV PCR and culture specimens were incomplete. There was also insufficient power to fully address neonatal safety and to determine any effects on neonatal HSV transmission. Finally, the safety of valacyclovir use only addressed maternal and fetal exposure from 36 weeks of gestation until delivery. No statement can be made regarding safety at earlier gestations.

In conclusion, valacyclovir prophylaxis was tolerated well in late pregnancy, had no adverse effects on the neonate and significantly reduced clinical recurrences at delivery, laboratory detection of HSV at delivery, and cesarean delivery for HSV. From a practical point of view, 11 women would need to be treated with valacyclovir to prevent 1 cesarean delivery for HSV. Only 7 women would need to be treated with valacyclovir to prevent one positive HSV PCR at delivery. Given the near epidemic rise in the incidence of genital HSV, antiviral prophylaxis late in pregnancy needs to be considered in managing this increasingly large number of women.


    Footnotes
 
Corresponding author: Jeanne S. Sheffield, MD, Department of Obstetrics & Gynecology, University of Texas Southwestern Medical Center at Dallas, 5323 Harry Hines Boulevard, Dallas, TX 75390-9032; e-mail: Jeanne.Sheffield{at}utsouthwestern.edu.

Financial Disclosure Funding for the study medications and laboratory evaluations was provided by Glaxo-Wellcome. Dr. George D. Wendel is a member of the GlaxoSmithKline speakers' bureau as of January 2006.

doi:10.1097/01.AOG.0000219749.96274.15


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
1. Fleming DT, McQuillan GM, Johnson RE, Nahmias AJ, Aral SO, Lee FK, et al. Herpes simplex virus type 2 in the United States, 1976–1994. N Engl J Med 1997;337:1105–11.[Abstract/Free Full Text]

2. Corey L, Handsfield HH. Genital herpes and public health: addressing a global problem. JAMA 2000;283:791–4.[Abstract/Free Full Text]

3. Brown ZA, Benedetti JK, Watts DH, Selke S, Berry S, Ashley RL, et al. A comparison between detailed and simple histories in the diagnosis of genital herpes complicating pregnancy. Am J Obstet Gynecol 1995;172:1299–303.[Medline]

4. Prober CG, Corey L, Brown ZA, Hensleigh PA, Frenkel LM, Bryson YJ, et al. The management of pregnancies complicated by genital infections with herpes simplex virus. Clin Infect Dis 1992;15:1031–8.[Medline]

5. Armstrong GL, Schillinger J, Markowitz L, Nahmias AJ, Johnson RE, McQuillan GM, et al. Incidence of herpes simplex virus type 2 infection in the United States. Am J Epidemiol 2001;153:912–20.[Abstract/Free Full Text]

6. De Schryver A, Meheus A. Epidemiology of sexually transmitted diseases: the global picture. Bull World Health Organ 1990;68:639–54.[Medline]

7. Whitley RJ. Herpes simplex virus infections of women and their offspring: implications for a developed society. Proc Natl Acad Sci U S A 1994;91:2441–7.[Abstract/Free Full Text]

8. American College of Obstetricians and Gynecologists. Management of herpes in pregnancy. ACOG Practice Bulletin 8. Washington, DC: ACOG; 1999.

9. Wald A, Zeh J, Selke S, Ashley RL, Corey L. Virologic characteristics of subclinical and symptomatic genital herpes infections. N Engl J Med 1995;333:770–5.[Abstract/Free Full Text]

10. Arvin AM, Prober CG. Herpes simplex virus infections. Pediatr Infect Dis J 1990;9:765–7.[Medline]

11. Braig S, Luton D, Sibony O, Edlinger C, Boissinot C, Blot P, et al. Acyclovir prophylaxis in late pregnancy prevents recurrent genital herpes and viral shedding. Eur J Obstet Gynecol Reprod Biol 2001;96:55–8.[Medline]

12. Brown ZA, Selke S, Zeh J, Kopelman J, Maslow A, Ashley RL, et al. The acquisition of herpes simplex virus during pregnancy. N Engl J Med 1997;337:509–15.[Abstract/Free Full Text]

13. Brown ZA, Benedetti J, Ashley R, Burchett S, Selke S, Berry S, et al. Neonatal herpes simplex virus infection in relation to asymptomatic maternal infection at the time of labor. N Engl J Med 1991;324:1247–52.[Abstract]

14. Whitley R, Arvin A, Prober C, Corey L, Burchett S, Plotkin S, et al. Predictors of morbidity and mortality in neonates with herpes simplex virus infections. The National Institute of Allergy and Infectious Disease Collaborative Antiviral Study Group. N Engl J Med 1991;324:450–4.[Abstract]

15. Sheffield JS, Hollier LM, Hill JB, Stuart GS, Wendel GD. Acyclovir prophylaxis to prevent herpes simplex virus recurrence at delivery; a systematic review. Obstet Gynecol 2003;102:1396–403.[Abstract/Free Full Text]

16. Weller S, Blum M, Doucette M, Burnette T, Cederberg DM, de Miranda P, et al. Pharmacokinetics of acyclovir pro-drug valacyclovir after escalating single- and multiple-dose administration to normal volunteers. Clin Pharmacol Ther 1993;54:595–605.[Medline]

17. Conant MA, Schacker TW, Murphy RL, Gold J, Crutchfield LT, Crooks RJ, et al. Valacyclovir versus acyclovir for herpes simplex virus infection in HIV-infected individuals: two randomized trials. Int J STD AIDS 2002;13:12–21.[Abstract/Free Full Text]

18. Corey L, Wald A, Patel R, Sacks SL, Tyring SK, Warren T, et al. Once-daily valacyclovir to reduce the risk of transmission of genital herpes. N Engl J Med 2004;350:11–20.[Abstract/Free Full Text]

19. Baker DA, Blythe JG, Miller JM. Once-daily valacyclovir hydrochloride for suppression of recurrent genital herpes. Obstet Gynecol 1999;94:103–6.[Abstract/Free Full Text]

20. Reitano M, Tyring S, Lang W, Thoming C, Worm A-M, Borelli S, et al. Valacyclovir for the suppression of recurrent genital herpes simplex virus infection: a large-scale dose range-finding study. International Valacyclovir HSV Study Group. J Infect Dis 1998;178:603–10.[Medline]

21. Kimberlin DW, Lin CY, Jacobs RF, Powell DA, Corey L, Gruber WC, et al. Safety and efficacy of high-dose intravenous acyclovir in the management of neonatal herpes simplex virus infections. Pediatrics 2001;108:230–8.[Abstract/Free Full Text]

22. Kimberlin D, Powell D, Gruber W, Diaz P, Arvin A, Kumar M, et al. Administration of oral acyclovir suppressive therapy after neonatal herpes simplex virus disease limited to the skin, eyes and mouth: results of a phase I/II trial. Pediatr Infect Dis J 1996;15:247–54.[Medline]

23. Bai X, Rogers BB, Harkins PC, Sommerauer J, Squires R, Rotondo K, et al. Predictive value of quantitative PCR-based viral burden analysis for eight human herpesviruses in pediatric solid organ transplant patients. J Mol Diagn 2000;2:191–201.[Abstract/Free Full Text]

24. Bai X, Hosler G, Rogers BB, Dawson DB, Scheuermann RH. Quantitative polymerase chain reaction for human herpesvirus diagnosis and measurement of Epstein-Barr virus burden in posttransplant lymphoproliferative disorder. Clin Chem 1997;43:1843–9.[Abstract/Free Full Text]

25. Hoang MP, Rogers BB, Dawson DB, Scheuermann RH. Quantitation of 8 human herpesviruses in peripheral blood of human immunodeficiency virus-infected patients and healthy blood donors by polymerase chain reaction. Am J Clin Pathol 1999;111:655–9.[Medline]

26. Division of AIDS table for grading the severity of adult and pediatric adverse events. December 2004. Available at: http://rcc.tech-res.com/tox_tables.htm. Retrieved January 3, 2006.

27. Gupta R, Krantz E, Selke S, Warren T, Vargas-Cortes M, et al. Valacyclovir and acyclovir for suppression of shedding of herpes simplex virus in the genital tract. J Infect Dis 2004;190:1374–81.[Medline]

28. Weller S, Blum MR, Doucette M, Burnette T, Cederberg DM, de Miranda P, et al. Pharmacokinetics of the acyclovir pro-drug valacyclovir after escalating single- and multiple-dose administration to normal volunteers. Clin Pharmacol Ther 1993;54:595–605.[Medline]




This article has been cited by other articles:


Home page
Arch Intern MedHome page
C. Cernik, K. Gallina, and R. T. Brodell
The Treatment of Herpes Simplex Infections: An Evidence-Based Review
Arch Intern Med, June 9, 2008; 168(11): 1137 - 1144.
[Abstract] [Full Text] [PDF]


Home page
Obstet GynecolHome page
A. B. Caughey, A. C. Urato, and P. Lurie
Valacyclovir Prophylaxis to Prevent Recurrent Herpes at Delivery: A Randomized Clinical Trial
Obstet. Gynecol., December 1, 2006; 108(6): 1550 - 1550.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Erratum (v108,p695)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sheffield, J. S.
Right arrow Articles by Wendel, G. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sheffield, J. S.
Right arrow Articles by Wendel, G. D., Jr
Related Collections
Right arrow Infectious disease
Right arrow Medical complications of pregnancy


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS