|
|
||||||||
ORIGINAL RESEARCH |
From the Grace Hill Neighborhood Health Centers Inc., St. Louis, Missouri; University of Louisville, Louisville, Kentucky; and Magee-Womens Hospital, Pittsburgh, Pennsylvania.
Address reprint requests to: Amy J. Ravin, MD, Grace Hill Neighborhood Health Centers, Inc., 7127 Cambridge Avenue, St. Louis, MO 63130; E-mail: amyr{at}gracehill.org.
| ABSTRACT |
|---|
|
|
|---|
METHODS: We conducted a case-control study of gynecologic cancer patients in a referral center who were group matched for demographics, tumor type, and treatment. The prevalence of the factor V Leiden mutation was determined in both cases and controls, and an odds ratio was calculated. The factor V Leiden mutation was detected using polymerase chain reaction amplification and nucleic acid restriction digest of deoxyribonucleic acid extracted from leukocytes.
RESULTS: Seventy-five patients were enrolled in the study. Seventy-four samples were available for analysis. There were no differences between the cases and controls with respect to age, race, body mass index, smoking, cancer type, high stage (III or IV) of cancer, or treatment modality. The odds ratio for having the factor V Leiden mutation in patients with venous thromboembolism was 0.3 (95% confidence interval 0.1, 1.7).
CONCLUSION: This study suggests that the factor V Leiden mutation is not associated with an increased risk of venous thromboembolism in gynecologic oncology patients. This contrasts with other studies showing a strong association between the factor V Leiden mutation and venous thromboembolism in cases of previously unexplained venous thromboembolism, and venous thromboembolism associated with other hypercoagulable states, such as pregnancy and oral contraceptive use. The risk of venous thromboembolism due to cancer outweighs the contribution of the factor V Leiden mutation.
Venous thromboembolism (deep venous thrombosis or pulmonary embolism) is a substantial cause of morbidity and occasional mortality. The annual incidence of venous thromboembolism in the general population is approximately 1/1000.1 In the gynecologic oncology population it is more common, with the incidence of postoperative venous thromboembolism ranging from 17% to 41%.25
Virchow6 originally described a triad of causes of thrombosis: stasis, vessel injury, and hypercoagulability. These have been translated into multiple, well-described risk factors. Some are acquired, such as age, immobility, fractures, surgery, pregnancy, and cancer. Others are inherited, such as deficiencies of protein S, protein C, and the factor V Leiden mutation.
The factor V Leiden mutation is the most common inherited risk factor for venous thrombosis. It occurs in approximately 5% of whites of American, Canadian, and northern European descent.79 Heterozygosity for this mutation confers a five- to ten-fold increased risk of venous thromboembolism.10,11
In the normal state, the activated coagulation cascade is limited by the protein C system. Protein C is activated by the binding of thrombin to thrombomodulin. This thrombinthrombomodulin complex activates protein C, which then activates factors Va and VIIIa, halting the coagulation cascade. This inhibits the conversion of factor X to Xa and of prothrombin to thrombin. The inactivation of factor V proceeds by cleavage of the protein at three sites. One of these is at arginine 506.12
The factor V Leiden mutation stems from a point mutation, a single nucleotide substitution, in the factor V gene (1691 guanine to adenine). This leads to a single peptide substitution at position 506 (arginine to glutamine) in the factor V protein. The altered factor V protein is then resistant to degradation by activated protein C.12 The mutation therefore disrupts one of the key regulatory pathways limiting the coagulation cascade.
The occurrence of clinical thrombosis appears to be increased in the presence of other risk factors. Most people with the mutation do not present with thrombosis. Rather, a second risk factor interacts synergistically with the mutation to induce thrombosis. For example, 40%78% of pregnant women who present with venous thromboembolism have activated protein C resistance or the factor V Leiden mutation.1317 With oral contraceptive use, the presence of the factor V Leiden mutation increases the odds ratio for thrombosis several-fold.18,19
Our hypothesis was that patients with factor V Leiden mutation and a gynecologic malignancy would have a much higher risk of venous thromboembolism than women having either risk factor alone. Cancer has long been identified as a hypercoagulable state, with many complex changes in the hemostatic system.20 The two risk factors would interact in a synergistic fashion to increase the risk. To test this hypothesis, we conducted a case-control study. We calculated the odds ratio for having the factor V Leiden mutation for gynecologic cancer patients with and without venous thromboembolism.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Subjects were enrolled if they had a gynecologic malignancy (ovarian, uterine, cervical, vulvar, or vaginal) as confirmed by histologic examination. Stage of cancer was determined by the standard evaluation of each cancer. Chart reviews and patient interviews were used to determine the age, race, weight, height, BMI (body mass index), tobacco use, stage and grade of cancer, cancer treatment(s), and family history of clotting disorders.
Cases were identified after patients were diagnosed with venous thromboembolism. Deep venous thrombosis was defined as clinically significant deep venous thrombosis confirmed by continuous-wave Doppler and real-time imaging ultrasonography. Pulmonary embolism suspected by clinical presentation was confirmed by ventilation/perfusion scan or thoracic helical computed tomography (CT) performed with the injection of contrast medium. Controls were gynecologic oncology in-patients without a history of venous thromboembolism who were having blood drawn for other routine testing. Iliac vein, mesenteric vein, and inferior vena cava thromboses were diagnosed by CT scan. Data was calculated with just the lower extremity and pulmonary thromboses and again including the abdominal thromboses.
Deoxyribonucleic acid (DNA) was extracted from lymphocytes using standard methods. The samples were then stored at -80C and assayed in batch. The factor V Leiden mutation was detected by polymerase chain reaction (PCR) amplification. Specific oligonucleotide primers to the areas surrounding the single nucleotide substitution of the Leiden mutation of the factor V gene were used to amplify the DNA. The 267 base pair fragment of the factor V gene that contains the Arg to Gln substitution was amplified using 0.5 U of Taq polymerase with 5'TCCCAGTGCTTAACAAGACCA3' forward primer, and 5'TGTTATCACACTGGTGCTAA3' reverse primer. Amplification involved an initial 2-minute denaturation at 94C, followed by 35 cycles of denaturation at 94C for 30 seconds, annealing at 55C for 30 seconds, and elongation at 72C for 30 seconds.
The product was then digested with 0.5 U of Mnl I. Mnl I digests the normal Factor V gene into three fragments. The factor V Leiden mutation resists digestion at one site and is therefore cut into only two fragments. The digestion products were separated by electrophoresis on 4% agarose minigels run at 120V in x 1 Tris, boric acid, and ethylenediaminetetraacetic acid for 45 minutes. The fragments were visualized by staining with ethidium bromide.
Statistical analysis was performed using SPSS software (SPSS Inc., Chicago, IL). The two groups were matched for demographic data, tumor type, and treatments. The groups were compared using
2 statistics, a two-sided Fisher exact test. When the cell frequency was greater than five, so that the number of samples in each group was small, a two-sided Pearson
2 was used. The odds ratio of having the factor V Leiden mutation was then calculated.
Prior to conducting the study, we conducted an analysis to determine the sample size needed to detect a difference between the case and control groups with 80% power and P value
0.05. If the prevalence of the mutation is assumed to be 5% in the control group, as is generally accepted for a white population, and the prevalence is assumed to be approximately 40% in the cases (close to that found in pregnancy and peripartum patients with venous thromboembolism),13,14,16,17 then 22 patients would be needed in each arm. If the prevalence of the mutation were 30% in the cases, then 36 patients would be needed in each arm of the study.
| RESULTS |
|---|
|
|
|---|
The median age of the subjects was 65 years. Ten percent of the patients were nonwhite. The median BMI was 27. Twenty-two percent of the patients were smokers. The frequencies of the cancers were as follows: 46% ovarian, 30% endometrial, 21% cervical, and 3% vulvar. Sixty-five percent of the patients had stage III or IV disease; 81% had undergone surgery, 71% had received chemotherapy, and 34% had received radiation therapy. There were no significant differences between the cases and controls with respect to any of the following: age, race, BMI, smoking, cancer type, stage, type of therapy (surgery, chemotherapy, radiation), because of group matching (Table 1
).
|
|
| DISCUSSION |
|---|
|
|
|---|
Most people with the mutation do not present with thrombosis. It appears that a second risk factor or insult must occur to lead to venous thromboembolism. This explains the significantly increased risk of venous thromboembolism in pregnancy or with oral contraceptive use: the more identifiable risk factors, the higher the risk of developing venous thromboembolism. The interactions appear to be more than additive. Several studies have evaluated combinations of risk factors and found this to be the case. For example, the combination of the factor V Leiden mutation and the prothrombin gene variant in pregnancy17 and the combination hyperhomocysteinemia and the factor V Leiden mutation in men24 are both settings with markedly increased risks for venous thromboembolism.
Based on this information, we predicted that in the setting of gynecologic malignancies, patients with the mutation would be much more likely to experience thrombotic events. If this were the case, then patients could be screened for the mutation when first diagnosed with a gynecologic malignancy. The factor V Leiden mutation could potentially be a simple marker for those patients most likely to suffer venous thromboembolism. Patients with the mutation would then be candidates for prophylactic anticoagulation. The morbidity and costs of venous thromboembolism in this high-risk group could be lowered. Additionally, patients who had experienced a thrombotic or embolic event could be tested. If they were found to be carriers of the mutation, they could be provided long-term treatment to prevent recurrences; however, our hypothesis was not supported by our data. Consequently, it does not seem worthwhile to test gynecologic cancer patients for the factor V Leiden mutation whether or not they have had venous thromboembolic events.
The other published studies evaluating the factor V Leiden mutation in oncology patients support our results. Green and colleagues25 looked at a series of oncology patients and controls without cancer. They measured activated protein C resistance and the factor V Leiden mutation, which normally accounts for more than 90% of activated protein C resistance.13 They did not find a significant difference between the two groups. Sifontes and coworkers26 found no association between the factor V Leiden mutation and venous thromobembolism in pediatric cancer patients. Nor did Otterson and colleagues27 in 353 hematologyoncology clinic patients, although their sample included both oncology patients and patients with nonmalignant hematologic disorders. Haim and colleagues28 performed a case-control study evaluating activated protein C resistance and the factor V Leiden mutation in cancer (various types) patients with and without venous thromboembolism and patients without malignancies with and without venous thromboembolism. They found a much higher incidence of activated protein C resistance in the oncology patients than in nononcology patients but no increased risk of the factor V Leiden mutation. Similar findings were noted by De Lucia and colleagues,29 who studied patients with advanced gastrointestinal cancer.
De Lucias group also looked at whether adding normal plasma to the cases plasma would correct the activated protein C resistance. In the presence of the Leiden mutation it would; however, the activated protein C resistance was not corrected. This suggests the presence of an inhibitory substance.29 It appears that the numerous alterations to the coagulation system in the setting of malignancy lead to a nonfunctioning protein C regulatory pathway. Thus, the presence of the Leiden mutation appears to be unimportant.
One of the limitations of our study is the small sample size. Our study has the power to detect a six- to eight-fold or greater difference in the rates of the factor V Leiden mutation in the cases compared with the controls. This magnitude of difference has been seen in multiple studies of the factor V Leiden mutation in the setting of pregnancy- and oral contraceptiverelated venous thromboembolism.13,14,16,17 Other have shown a smaller, usually four-fold, difference.18,19 If there were a smaller effect of the factor V Leiden mutation, our study would not have the power to detect that difference. Yet our data did not show any association between the factor V Leiden mutation and thromboembolism. In fact, the data suggest the opposite. The prevalence of the mutation is higher in the controls than in the cases. This difference did not meet statistical significance. It seems unlikely that there is any protective effect of the factor V mutation or that such a suggestion is real. A much larger study would be needed to state with confidence that there is no association or at most a very minor contribution.
Overall, our study adds to the growing body of evidence that demonstrates that in malignancy, unlike other settings, the factor V Leiden mutation does not play a significant role in the risk of venous thromboembolism. The high risk of venous thromboembolism in gynecologic oncology patients appears to be from their cancer and treatment, not from an underlying inherited tendency to thrombosis.
| Footnotes |
|---|
The authors thank Robert Powers, PhD, Leslie Minich, BS, Marcia Gallagher, BS, and Lisa Wiland, MA for technical assistance.
Received February 5, 2002. Received in revised form June 8, 2002. Accepted July 25, 2002.
| REFERENCES |
|---|
|
|
|---|
2. Clarke-Pearson DL, Synan IS, Coleman E, Hinshaw W, Creasman WT. The natural history of postoperative venous thromboemboli in gynecologic oncology: A prospective study of 382 patients. Am J Obstet Gynecol 1984; 148:10514.[Medline]
3. Clark-Pearson DL, Synan IS, Hinshaw WM, Coleman E, Creasman WT. Prevention of postoperative venous thromboembolism by external pneumatic calf conpression in patients with gynecologic malignancy. Obstet Gyncol 1984;63:928.
4. Jeffcote TNA, Tindall VR. Venous thrombosis and embolism in obstetrics and gynecology. Aust N Z J Obstet Gynaecol 1965;5:119.[Medline]
5. Walsh JJ, Bonnar J, Wright FW. A study of pulmonary embolism and deep leg vein thrombosis after major gynecologic surgery using labeled fibrinogen, phlebography, and lung scanning. J Obstet Gynaecol Br Commonw 1974;31:3116.
6. Virchow R. Gesammelte Abhandlungen zur wissenschaftlichen Medizin. Frankfurt, Germany: Staatsdruckerei, 1856.
7. Rees DC, Cox M, Clegg JB. World distribution of factor V Leiden. Lancet 1995;346:11334.[Medline]
8. Lee DH, Henderson PA, Blajchman MA. Prevalence of factor V Leiden in a Canadian blood donor population. Can Med Assoc J 1996;155:2859.[Abstract]
9. Ridker PM, Hennekens CH, Lindpainter K, Stampfer MJ, Eisenberg PR, Miletich JP. Mutation in the gene coding for coagulation factor V and the risk of myocardial infarction, stroke, and venous thrombosis in apparently healthy men. N Engl J Med 1995;332:9127.
10. Rosendaal FR, Koster T, Vandenbroucke JP, Reitsma PH. High risk of thrombosis in patients homozygous for factor V Leiden (activated protein C resistance). Blood 1995;85: 15048.
11. Koster T, Rosendaal FR, de Ronde H, Vandenbrouke JP, Bertina RM. Venous thrombosis due to poor anticoagulant response to activated protein C: Leiden thrombophilia study. Lancet 1993;18:15036.
12. Hillarp A, Zoller B, Dahlback B. Activated protein C Resistenace as a basis for venous thrombosis. Am J Med 1996;101: 534540.[Medline]
13. Hellgren M, Svensson PJ, Dahlback B. Resistance to activated protein C as a basis for venous thromboembolism associated with pregnancy and oral contraceptives. Am J Obstet Gynecol 1995;173:2103.[Medline]
14. Hallak M, Senderowicz J, Casse A. Activated protein C resistance (factor V Leiden) associated with thrombosis in pregnancy. Am J Obstet Gynecol 1997;176:88993.[Medline]
15. Bokarewa MI, Bremme K, Blomback M. Arg 506-Gln mutation in factor V and risk of thrombosis during pregnancy. Br J Haematol 1996;92:4738.[Medline]
16. Gerhardt A, Scharf RE, Beckmann MW, Struve S, Bender HG. Prothrombin and factor V mutations in women with a history of thrombosis during pregnancy and the pueriperium. N Engl J Med 2000;342:37480.
17. Dizon-Townsend DS, Nelson LM, Jang H, Warner MW, Ward K. The incidence of the factor V Leiden mutation in obstetrical population and its relation to deep venous thrombosis. Am J Obstet Gynecol 1997;176:8836.[Medline]
18. Bloemenkamp KWM, Rosendaal FR, Helmerhorst FM, Buller HR, Vandenbroucke JP. Enhancement by factor V Leiden mutation of risk of deep vein thrombosis associated with oral contraceptives containing a third generation progestogen. Lancet 1995;346:15936.[Medline]
19. Vandenbrouke JP, Koster T, Briet E, Reitsma RM, Rosendaal FR. Increased risk of venous thrombosis in oral contraceptive users who are carriers of factor V Leiden mutation. Lancet 1994;344:14537.[Medline]
20. Green KB, Silverstein RL. Hypercoagulability in cancer. Hematol Oncol Clin North Am 1996;1092:499530.
21. Goodman LR. CT diagnosis of pulmonary embolism and deep venous thrombosis. Radiographics 2000;20:12015.
22. Rosenadaal FR. Venous thrombosis: Prevalence and interaction of risk factors. Haemostasis 1999;29 Suppl 1:19.
23. Phillips MD. Interrelated risk factors for venous thromboembolism. Circulation 1997;95:174951.
24. Ridker PM, Hennekens CH, Selhub J, Miletich JP, Malinow MR, Stampfer MJ. Interrelation of hyperhomocyst(e)inemia, factor V Leiden and the risk of future venous thromboembolism. Circulation 1997;95:177782.
25. Green D, Maliekel K, Sushko E, Akhtar R, Soff GA. Activated protein C resistance in cancer patients. Haemostasis 1997;27:1128.[Medline]
26. Sifontes M, Nuss R, Hunger SP, Wilimas J, Jacobson LJ. The factor V Leiden mutation in children with cancer and thrombosis. Br J Haematol 1997;96:4849.[Medline]
27. Otterson GA, Monahan B.P, Harold N, Steinberg JN, Kaye FJ. Clinical significance of the FV:Q 506 mutation in unselected oncology patients. Am J Med 1996;101: 40612.[Medline]
28. Haim N, Lanir N, Hoffman R, Haum A, Tsalik M, Brenner B. Acquired activated protein C resistance is common in cancer patients and is associated with venous thromboembolism. Am J Med 2001;110:916.[Medline]
29. De Lucia D, De Vita F, Orditura M, Renis V, Belli A, Conte M, et al. Hypercoagulable state in patients with advanced gastrointestinal cancer: Evidence for an acquired resistance to activated protein C. Tumori 1997; 83:94852.[Medline]
This article has been cited by other articles:
![]() |
B. S. Donahue Factor V Leiden and Perioperative Risk Anesth. Analg., June 1, 2004; 98(6): 1623 - 1634. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |